Great presentation! You talked a little bit about how in figure 2, under your result, that one of the bands did not amplify enough which caused you to use verified primers for the rest of the experiment do you happen to know which ones you used?
Hi Leah. Thank you for your question. Both my designed primers and the validated primers were for UbiconE2. My designed primers were:
Forward: : AAAGGATTTGGAAGCTATGC
Reverse: CGTAACTCCATAAGAAAGCC
and the validated primers I used were:
Forward: TGACCAAGAGACTCCAAAAG
Reverse: AAATATGCTCATGGTCAGGG
To make it more clear, primers are a piece of the single stranded DNA sequence that provide a starting point for DNA synthesis and amplify the gene, My designed primers did amplify my specific gen (UbiconE2), however I used the validated primers because they showed better, more accurate gene amplification results.
Hi Gabe. Thank you for your question. I designed my primer using the application Primer3Plus which takes the cDNA and gDNA of my specific gene and finds different sets of primers that could potentially work. I had to choose the best primer of the one listed by evaluating the Primer size, Tm, and GC% (I wanted the smallest options). Using this information I was able to determine which one to use. Thank you
Hi Jennifer. Thank you for your question. I think the band for the primer verification gel electrophoresis was so dim both in part to human error where I probably did not inject the PCR product for my cDNA completely into the lane. But also, it was probably dim because the primer I designed was not the most effective primer to amplify the cDNA.
Hi Kevin. That is a great question! To answer that more research would probably need to be done to test UbiconE2 function at different stages of the cell cycle. However, I can hypothesize that it probably is not always active since based off of previously conducted research, ubiquitin is linked to G1/S regulation of the cell cycle.
Hi Shreya. Thank you for your question. Under DNA damage, UbiconE2 shows an increased amount of expression compared to cells that are not treated with DNA damage. This means that UbiconE2 plays a role in the DNA damage repair pathway since it is more highly express (it’s functions are being used more) than under normal conditions. So, it helps with repair of the damaged DNA. I hope that help!
Great presentation! You talked a little bit about how in figure 2, under your result, that one of the bands did not amplify enough which caused you to use verified primers for the rest of the experiment do you happen to know which ones you used?
Hi Leah. Thank you for your question. Both my designed primers and the validated primers were for UbiconE2. My designed primers were:
Forward: : AAAGGATTTGGAAGCTATGC
Reverse: CGTAACTCCATAAGAAAGCC
and the validated primers I used were:
Forward: TGACCAAGAGACTCCAAAAG
Reverse: AAATATGCTCATGGTCAGGG
To make it more clear, primers are a piece of the single stranded DNA sequence that provide a starting point for DNA synthesis and amplify the gene, My designed primers did amplify my specific gen (UbiconE2), however I used the validated primers because they showed better, more accurate gene amplification results.
How was your custom primer created?
Hi Gabe. Thank you for your question. I designed my primer using the application Primer3Plus which takes the cDNA and gDNA of my specific gene and finds different sets of primers that could potentially work. I had to choose the best primer of the one listed by evaluating the Primer size, Tm, and GC% (I wanted the smallest options). Using this information I was able to determine which one to use. Thank you
Why do you think the band was initially so dim?
Hi Jennifer. Thank you for your question. I think the band for the primer verification gel electrophoresis was so dim both in part to human error where I probably did not inject the PCR product for my cDNA completely into the lane. But also, it was probably dim because the primer I designed was not the most effective primer to amplify the cDNA.
Would the UbiconE2 gene be active in a certain part in the cell cycle or always active to repair.
Hi Kevin. That is a great question! To answer that more research would probably need to be done to test UbiconE2 function at different stages of the cell cycle. However, I can hypothesize that it probably is not always active since based off of previously conducted research, ubiquitin is linked to G1/S regulation of the cell cycle.
What are other medicinal applications can be further done with UbiconE2 besides treating cancer?
Nice presentation! What exact applications do you think your findings might have in wider science/medicine?
How might increased expression of the UbiconE2 gene affect the DNA damage repair pathway?
Hi Shreya. Thank you for your question. Under DNA damage, UbiconE2 shows an increased amount of expression compared to cells that are not treated with DNA damage. This means that UbiconE2 plays a role in the DNA damage repair pathway since it is more highly express (it’s functions are being used more) than under normal conditions. So, it helps with repair of the damaged DNA. I hope that help!