8 thoughts on “C85 – Gallegos

  1. What are the experiments/lab tests you suggest to test the the phosphatase aspect and other functions of the Pprs42 gene?

    1. When we looked at the blast results it came up with phosphate aspects, as a class the groups with this therm number found that it had phosphate aspects, no further tests are to be done to test the phosphate aspect of Pprs42 gene.

  2. What exactly is DSBs and how does T. Thermophillia repair it? What primers were exactly used to be annealed?

    1. DSB is double strand breaks, a form of DNA damage, how T. Thermophilia repair has many factors that it takes to fix, there is not one set repair form that can be stated. The exact primers used were FWD TGCACTTCCTGACAAAACTC and RVS ATCAAATGGAGATGCAGAGC.

    1. This is done by placing our gene into primer3plus and then checked the necessary requirements. Then ran through blast. Had set points that were necessary to have.

    1. Within Tetrahymena Thermophila there are many different genes. When discussing homologous and non homologous it is in reference to the genes. The genes we wanted were true homologs to humans

Leave a Reply