We’re not totally sure. All we know is that since Cory has a single exon it’s likely a single use gene– meaning that since theres no alternative splicing theres little to no possibility that the gene can have more than one function. This could potential lead us to believe the gene has a very minor / insignificant function but thats just a quick hypothesis
Both our designed primer and the island primer consists of a forward and reverse component. For our designed primer the sequences are FWD: TGTTGAGGGCTTTTCATCTG and RVS: CTGCAAGGATCGTCAGATTC. I’m unsure about the sequences of the island primer though.
Do you have any predictions for what the Cory gene could be involved in other than DNA repair?
We’re not totally sure. All we know is that since Cory has a single exon it’s likely a single use gene– meaning that since theres no alternative splicing theres little to no possibility that the gene can have more than one function. This could potential lead us to believe the gene has a very minor / insignificant function but thats just a quick hypothesis
What are the components of your primer?
Both our designed primer and the island primer consists of a forward and reverse component. For our designed primer the sequences are FWD: TGTTGAGGGCTTTTCATCTG and RVS: CTGCAAGGATCGTCAGATTC. I’m unsure about the sequences of the island primer though.